ID: 1035732019_1035732023

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1035732019 1035732023
Species Human (GRCh38) Human (GRCh38)
Location 8:1860170-1860192 8:1860197-1860219
Sequence CCCTGGACGAAGAAGGTACTGCT TCCTCTCCACGCCCCCGAAGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 79} {0: 2, 1: 0, 2: 2, 3: 13, 4: 104}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!