ID: 1036209546_1036209556

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 1036209546 1036209556
Species Human (GRCh38) Human (GRCh38)
Location 8:6831254-6831276 8:6831289-6831311
Sequence CCGAAAGATCCTTCTCTGCCTTC GGAAGGGCCCTGTCTTTTCAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 3, 3: 14, 4: 175}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!