ID: 1036239825_1036239833

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1036239825 1036239833
Species Human (GRCh38) Human (GRCh38)
Location 8:7072296-7072318 8:7072337-7072359
Sequence CCTTTTTAACCTTTCAAGTGCAT AAGGGCCTATTGAACTCTGGGGG
Strand - +
Off-target summary No data {0: 28, 1: 27, 2: 19, 3: 18, 4: 116}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!