ID: 1036242724_1036242731

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1036242724 1036242731
Species Human (GRCh38) Human (GRCh38)
Location 8:7092951-7092973 8:7092976-7092998
Sequence CCTATGAGCTCCCGGTGTCCTGC ACGTGGGCCCCTGAGTCACCGGG
Strand - +
Off-target summary {0: 3, 1: 12, 2: 3, 3: 8, 4: 121} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!