ID: 1036246975_1036246980

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1036246975 1036246980
Species Human (GRCh38) Human (GRCh38)
Location 8:7126257-7126279 8:7126289-7126311
Sequence CCCGAGGTTTGGAACGATGGGAA ATCTGTGTTTAAGGTGAGAAGGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 1, 3: 19, 4: 297}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!