ID: 1036314244_1036314247

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 1036314244 1036314247
Species Human (GRCh38) Human (GRCh38)
Location 8:7708391-7708413 8:7708427-7708449
Sequence CCTGCTGTCGGCAGATCTGAGCT CCTTCTACCCACAGTCCTCCAGG
Strand - +
Off-target summary No data {0: 18, 1: 47, 2: 54, 3: 62, 4: 293}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!