ID: 1036334289_1036334296

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1036334289 1036334296
Species Human (GRCh38) Human (GRCh38)
Location 8:7858087-7858109 8:7858133-7858155
Sequence CCATACACATGGGACACCTCTGG CAATTGTTATGAAGCCCAGGGGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 1, 3: 4, 4: 121} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!