ID: 1036432248_1036432253

View in Genome Browser

Spacer: -7

Left Crispr Right Crispr
Crispr ID 1036432248 1036432253
Species Human (GRCh38) Human (GRCh38)
Location 8:8702100-8702122 8:8702116-8702138
Sequence CCGGACCCGCGGTTTCGGTCAGA GGTCAGACCCGCCCGCGGGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 14} {0: 1, 1: 0, 2: 0, 3: 4, 4: 73}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!