ID: 1036495561_1036495569

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1036495561 1036495569
Species Human (GRCh38) Human (GRCh38)
Location 8:9267210-9267232 8:9267239-9267261
Sequence CCTCCATTTCCTGTGCTCCTTAA CTTGGAAGGGGACTGTTTGATGG
Strand - +
Off-target summary No data No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!