ID: 1036723920_1036723935

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1036723920 1036723935
Species Human (GRCh38) Human (GRCh38)
Location 8:11201681-11201703 8:11201734-11201756
Sequence CCCATCAGGTTGACCCCTCGGCG GTCCAAAGTGATCCCTGGAGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 22} {0: 1, 1: 1, 2: 1, 3: 12, 4: 146}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!