ID: 1036723921_1036723932

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 1036723921 1036723932
Species Human (GRCh38) Human (GRCh38)
Location 8:11201682-11201704 8:11201729-11201751
Sequence CCATCAGGTTGACCCCTCGGCGT AGGCGGTCCAAAGTGATCCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 37} {0: 1, 1: 0, 2: 0, 3: 4, 4: 64}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!