|
Left Crispr |
Right Crispr |
| Crispr ID |
1036848699 |
1036848703 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
8:12186767-12186789
|
8:12186786-12186808
|
| Sequence |
CCAGGCCTGTGGTACCGTGGGAG |
GGAGATGATGGCTGTGCTCTTGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 3, 1: 5, 2: 4, 3: 7, 4: 138} |
{0: 7, 1: 3, 2: 1, 3: 30, 4: 287} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|