ID: 1036848699_1036848704

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 1036848699 1036848704
Species Human (GRCh38) Human (GRCh38)
Location 8:12186767-12186789 8:12186810-12186832
Sequence CCAGGCCTGTGGTACCGTGGGAG GAGTGTGACTGAGCCTCCTGAGG
Strand - +
Off-target summary {0: 3, 1: 5, 2: 4, 3: 7, 4: 138} {0: 4, 1: 4, 2: 7, 3: 31, 4: 204}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!