ID: 1037814101_1037814119

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1037814101 1037814119
Species Human (GRCh38) Human (GRCh38)
Location 8:22102879-22102901 8:22102928-22102950
Sequence CCCCACATGATCCTCGCCAGAAC CTGAGCCAGCACCAGGGCGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 79} {0: 1, 1: 0, 2: 4, 3: 31, 4: 313}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!