ID: 1037814102_1037814120

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1037814102 1037814120
Species Human (GRCh38) Human (GRCh38)
Location 8:22102880-22102902 8:22102929-22102951
Sequence CCCACATGATCCTCGCCAGAACG TGAGCCAGCACCAGGGCGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 38} {0: 1, 1: 0, 2: 2, 3: 14, 4: 163}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!