ID: 1037862207_1037862214

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 1037862207 1037862214
Species Human (GRCh38) Human (GRCh38)
Location 8:22413497-22413519 8:22413531-22413553
Sequence CCCAAGATGATTCGACTCCCCTG TGAAAGTGTTGTTTCCCTGGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 86} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!