ID: 1038345050_1038345066

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 1038345050 1038345066
Species Human (GRCh38) Human (GRCh38)
Location 8:26725061-26725083 8:26725107-26725129
Sequence CCCCACCCAAATGTCATCTTGAA TGTCATGGGAGGGACCTGGTGGG
Strand - +
Off-target summary {0: 106, 1: 8136, 2: 11485, 3: 9529, 4: 7124} {0: 442, 1: 1330, 2: 3684, 3: 5420, 4: 6963}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!