ID: 1038516995_1038516997

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1038516995 1038516997
Species Human (GRCh38) Human (GRCh38)
Location 8:28195732-28195754 8:28195757-28195779
Sequence CCTCGGAGGGAGGAATTAAGGTC CATTTTACAAATGAGAAACTCGG
Strand - +
Off-target summary No data {0: 2, 1: 15, 2: 114, 3: 563, 4: 2118}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!