ID: 1038612258_1038612275

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 1038612258 1038612275
Species Human (GRCh38) Human (GRCh38)
Location 8:29068153-29068175 8:29068198-29068220
Sequence CCGACCCACACTAAGGTGCCACT TCGGGAGTCCTAAGGCGGGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 118} {0: 1, 1: 0, 2: 0, 3: 1, 4: 44}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!