ID: 1038763172_1038763179

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 1038763172 1038763179
Species Human (GRCh38) Human (GRCh38)
Location 8:30403626-30403648 8:30403676-30403698
Sequence CCTCCTAGCTAAATCTGTGTATA CTCTTAGAAGTGGAATTTCTGGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 0, 3: 12, 4: 134} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!