ID: 1039088247_1039088255

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1039088247 1039088255
Species Human (GRCh38) Human (GRCh38)
Location 8:33801022-33801044 8:33801047-33801069
Sequence CCACTGAGAAAGCTGGCTAATTG AAGGGGCTGGATTTCAGGGTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 2, 3: 27, 4: 277}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!