ID: 1039288942_1039288946

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1039288942 1039288946
Species Human (GRCh38) Human (GRCh38)
Location 8:36073152-36073174 8:36073172-36073194
Sequence CCAAGCACCAGGGGAAACACCAA CAATCCCGAAGCACCTCGCTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 3, 4: 26}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!