ID: 1039311590_1039311594

View in Genome Browser

Spacer: -5

Left Crispr Right Crispr
Crispr ID 1039311590 1039311594
Species Human (GRCh38) Human (GRCh38)
Location 8:36322447-36322469 8:36322465-36322487
Sequence CCACCAGCCTGGCTGCGCAGGTT AGGTTTCCAAGTAGAGGACGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 7, 3: 18, 4: 205} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!