ID: 1039426875_1039426880

View in Genome Browser

Spacer: -6

Left Crispr Right Crispr
Crispr ID 1039426875 1039426880
Species Human (GRCh38) Human (GRCh38)
Location 8:37493498-37493520 8:37493515-37493537
Sequence CCCACAGGTCCCATTCTGTCACA GTCACACAGACTCCAGGAGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 156} {0: 1, 1: 0, 2: 1, 3: 28, 4: 253}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!