ID: 1039426876_1039426885

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1039426876 1039426885
Species Human (GRCh38) Human (GRCh38)
Location 8:37493499-37493521 8:37493526-37493548
Sequence CCACAGGTCCCATTCTGTCACAC TCCAGGAGAAGGCGGCGGCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 14, 4: 203} {0: 1, 1: 0, 2: 1, 3: 20, 4: 241}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!