ID: 1039669556_1039669559

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 1039669556 1039669559
Species Human (GRCh38) Human (GRCh38)
Location 8:39581030-39581052 8:39581067-39581089
Sequence CCGTCTCTTGCTAAGATGGGGGC CAGAGCATTACACATGGGTTAGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 2, 3: 8, 4: 134}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!