ID: 1039848398_1039848403

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1039848398 1039848403
Species Human (GRCh38) Human (GRCh38)
Location 8:41342352-41342374 8:41342382-41342404
Sequence CCTCCTTTCAGGCCACTGTGGGG AAGAAGAAGAGTTTGCAAACGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 163} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!