ID: 1039856791_1039856796

View in Genome Browser

Spacer: 2

Left Crispr Right Crispr
Crispr ID 1039856791 1039856796
Species Human (GRCh38) Human (GRCh38)
Location 8:41421990-41422012 8:41422015-41422037
Sequence CCAGCTACTCGGGAGGCTGAGGC GAGAATGGCGTGAAGCCCAGGGG
Strand - +
Off-target summary {0: 94911, 1: 257638, 2: 218586, 3: 135882, 4: 139272} {0: 2, 1: 407, 2: 1600, 3: 38713, 4: 55008}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!