ID: 1039978334_1039978341

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 1039978334 1039978341
Species Human (GRCh38) Human (GRCh38)
Location 8:42385662-42385684 8:42385693-42385715
Sequence CCCAGCACAAAGTCCAGGCTCCT GAGCATTTCCCAATTTCTGGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 28, 4: 262} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!