|
Left Crispr |
Right Crispr |
| Crispr ID |
1040077165 |
1040077182 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
8:43247469-43247491
|
8:43247505-43247527
|
| Sequence |
CCGCAGCCCCGCAGCCCCGCAGC |
AGCCCCGCAGCACCTGGGGCGGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 31, 1: 28, 2: 67, 3: 229, 4: 970} |
No data |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|