ID: 1040106168_1040106171

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 1040106168 1040106171
Species Human (GRCh38) Human (GRCh38)
Location 8:43543319-43543341 8:43543339-43543361
Sequence CCTTCCACAGAGGCTGCAGAGGG GGGAACCTGTGCATTACTCATGG
Strand - +
Off-target summary {0: 1, 1: 2, 2: 6, 3: 74, 4: 507} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!