ID: 1040332988_1040332995

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 1040332988 1040332995
Species Human (GRCh38) Human (GRCh38)
Location 8:46401729-46401751 8:46401753-46401775
Sequence CCCACCCAGAGGGGGGAGCACCA GGAGAATTCTGAGAAAGGAGAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 5, 3: 52, 4: 487}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!