ID: 1040911943_1040911945

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1040911943 1040911945
Species Human (GRCh38) Human (GRCh38)
Location 8:52528388-52528410 8:52528415-52528437
Sequence CCTGCCATCTTCTGCAGATAACA TGCTTTTGAGAGACAGCTCTTGG
Strand - +
Off-target summary No data {0: 2, 1: 203, 2: 202, 3: 192, 4: 337}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!