ID: 1041152125_1041152131

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 1041152125 1041152131
Species Human (GRCh38) Human (GRCh38)
Location 8:54945310-54945332 8:54945363-54945385
Sequence CCAGGGGAAGCAAGAGCTCCCCT CTGCTCTGCTTTGCTGAACCTGG
Strand - +
Off-target summary No data {0: 1, 1: 1, 2: 1, 3: 32, 4: 234}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!