ID: 1041823904_1041823913

View in Genome Browser

Spacer: 18

Left Crispr Right Crispr
Crispr ID 1041823904 1041823913
Species Human (GRCh38) Human (GRCh38)
Location 8:62069352-62069374 8:62069393-62069415
Sequence CCTCTGTCCTCCCAGTGTTAAAT GCTTGGAGGAGAATGGAGATAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 203} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!