|
Left Crispr |
Right Crispr |
| Crispr ID |
1042001060 |
1042001066 |
| Species |
Human (GRCh38) |
Human (GRCh38) |
| Location |
8:64123988-64124010
|
8:64124022-64124044
|
| Sequence |
CCCGTAACAAGCCAAGAGCTGTC |
GAGTAGTTATCTGCAGAAGATGG |
| Strand |
- |
+ |
| Off-target summary |
{0: 7, 1: 178, 2: 193, 3: 137, 4: 229} |
{0: 178, 1: 192, 2: 102, 3: 110, 4: 247} |
| Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
| Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
|
No off target data available for this pair!
|