ID: 1042001064_1042001067

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 1042001064 1042001067
Species Human (GRCh38) Human (GRCh38)
Location 8:64124012-64124034 8:64124026-64124048
Sequence CCCAAAAGGAGAGTAGTTATCTG AGTTATCTGCAGAAGATGGCAGG
Strand - +
Off-target summary {0: 4, 1: 0, 2: 5, 3: 18, 4: 148} {0: 185, 1: 187, 2: 104, 3: 111, 4: 225}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!