ID: 1042075897_1042075904

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 1042075897 1042075904
Species Human (GRCh38) Human (GRCh38)
Location 8:64994264-64994286 8:64994291-64994313
Sequence CCTCTTACTACTATTACCTCTAC ATGGAAGCTGGGTGAAGGCAGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 4, 3: 69, 4: 594}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!