ID: 1043452832_1043452835

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 1043452832 1043452835
Species Human (GRCh38) Human (GRCh38)
Location 8:80385250-80385272 8:80385282-80385304
Sequence CCCCATTGCTTGTTTTCTCAGGT ATCAGATAGTTGTAGATATGCGG
Strand - +
Off-target summary No data {0: 5262, 1: 3707, 2: 6175, 3: 4464, 4: 2820}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!