ID: 1044414213_1044414222

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 1044414213 1044414222
Species Human (GRCh38) Human (GRCh38)
Location 8:91917707-91917729 8:91917759-91917781
Sequence CCTCAACCTGGACAGGATCCAGC TAAACCTATGGAAAAGCTTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 10, 4: 193} {0: 1, 1: 1, 2: 0, 3: 21, 4: 170}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!