ID: 1044635551_1044635560

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1044635551 1044635560
Species Human (GRCh38) Human (GRCh38)
Location 8:94320224-94320246 8:94320254-94320276
Sequence CCCTCCCCTGAGCACACAGATTC ATGCCACAGAGGCACTGCTGGGG
Strand - +
Off-target summary {0: 1, 1: 6, 2: 34, 3: 139, 4: 513} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!