ID: 1045279214_1045279219

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1045279214 1045279219
Species Human (GRCh38) Human (GRCh38)
Location 8:100735167-100735189 8:100735211-100735233
Sequence CCATATGCAGGAAGCTCGCATTT TTTTCAAAACTTGTATTTTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 78} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!