ID: 1045357379_1045357389

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 1045357379 1045357389
Species Human (GRCh38) Human (GRCh38)
Location 8:101401910-101401932 8:101401954-101401976
Sequence CCCCCTCTGCATTCTGTCTCTGA GTCAGGTCAATGACATTGACAGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 0, 3: 30, 4: 119}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!