ID: 1046681112_1046681119

View in Genome Browser

Spacer: 26

Left Crispr Right Crispr
Crispr ID 1046681112 1046681119
Species Human (GRCh38) Human (GRCh38)
Location 8:117171300-117171322 8:117171349-117171371
Sequence CCAAGGGCCTTTGAAACCAGCCC TGATACCCACGACATTCTTGGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 1, 3: 14, 4: 197} {0: 1, 1: 0, 2: 0, 3: 6, 4: 63}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!