ID: 1047944308_1047944312

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 1047944308 1047944312
Species Human (GRCh38) Human (GRCh38)
Location 8:129859390-129859412 8:129859416-129859438
Sequence CCGGATAACTGCAGGTGGGCCTG AATGTCAGGCCCTCCACAGGAGG
Strand - +
Off-target summary No data {0: 1, 1: 43, 2: 164, 3: 103, 4: 184}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!