ID: 1048009838_1048009844

View in Genome Browser

Spacer: 5

Left Crispr Right Crispr
Crispr ID 1048009838 1048009844
Species Human (GRCh38) Human (GRCh38)
Location 8:130446658-130446680 8:130446686-130446708
Sequence CCTCTCTACCAGGAGGCTTTCTC CTGTGGGATCTTGCCTAGCCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 25, 4: 196} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!