ID: 1048100253_1048100259

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 1048100253 1048100259
Species Human (GRCh38) Human (GRCh38)
Location 8:131343190-131343212 8:131343228-131343250
Sequence CCGGATCCAGAAGGGTGGAAGTC ACAATGGTGATCAGCAGCGGTGG
Strand - +
Off-target summary {0: 2, 1: 29, 2: 72, 3: 93, 4: 204} No data
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!