ID: 1048141533_1048141537

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 1048141533 1048141537
Species Human (GRCh38) Human (GRCh38)
Location 8:131799573-131799595 8:131799602-131799624
Sequence CCTCACTTTAAAATGAGAACCTT GACATCTATGGGCCTTTTCAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 381} {0: 1, 1: 0, 2: 0, 3: 7, 4: 122}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!