ID: 1048434451_1048434456

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 1048434451 1048434456
Species Human (GRCh38) Human (GRCh38)
Location 8:134403045-134403067 8:134403067-134403089
Sequence CCTTCTGGTATCCACACCCACAT TGTTGTCTCACACTGACTCTGGG
Strand - +
Off-target summary No data {0: 1, 1: 0, 2: 1, 3: 28, 4: 204}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!