ID: 1049223163_1049223175

View in Genome Browser

Spacer: 7

Left Crispr Right Crispr
Crispr ID 1049223163 1049223175
Species Human (GRCh38) Human (GRCh38)
Location 8:141437012-141437034 8:141437042-141437064
Sequence CCTTCCCGCCATGGGGAGCTGTG GCCTGGCCCTGCCCGCCGTGGGG
Strand - +
Off-target summary No data {0: 7, 1: 1, 2: 1, 3: 37, 4: 305}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!